scikit-bio

scikit-bio

Overview

Targets scikit-bio 0.7.4. Use it for sequence manipulation, alignment, phylogenetics, microbial ecology, and multivariate statistics. Native tests exercise small synthetic fixtures; examples with filenames or undefined inputs are workflow templates. See review evidence and boundaries.

When to Use This Skill

This skill should be used when the user:

• Works with biological sequences (DNA, RNA, protein)
• Needs to read/write biological file formats (FASTA, FASTQ, GenBank, Newick, BIOM, etc.)
• Performs sequence alignments or searches for motifs
• Constructs or analyzes phylogenetic trees
• Calculates diversity metrics (alpha/beta diversity, UniFrac distances)
• Performs ordination analysis (PCoA, CCA, RDA)
• Runs statistical tests on biological/ecological data (PERMANOVA, ANOSIM, Mantel)
• Analyzes microbiome or community ecology data
• Works with protein embeddings from language models
• Needs to manipulate biological data tables

Core Capabilities

1. Sequence Manipulation

Work with biological sequences using specialized classes for DNA, RNA, and protein data.

Key operations:

• Read/write sequences from FASTA, FASTQ, GenBank, EMBL formats
• Sequence slicing, concatenation, and searching
• Reverse complement, transcription (DNA→RNA), and translation (RNA→protein)
• Find motifs and patterns using regex
• Calculate distances (Hamming, k-mer based)
• Handle sequence quality scores and metadata

Common patterns:

import skbio

# Read sequences from file
seq = skbio.DNA.read('input.fasta')

# Sequence operations
rc = seq.reverse_complement()
rna = seq.transcribe()
protein = rna.translate()

# Find motifs
motif_positions = seq.find_with_regex('(ATG[ACGT]{3})')  # capture group required

# Check for properties
has_degens = seq.has_degenerates()
seq_no_gaps = seq.degap()

Important notes:

• Use DNA, RNA, Protein classes for grammared sequences with validation
• Use Sequence class for generic sequences without alphabet restrictions
• FASTQ quality scores load into positional metadata; specify the known phred_offset=33 or variant (do not infer encoding from the filename). Translation needs an explicit genetic code/frame and a decision about incomplete codons.
• Metadata types: sequence-level (ID, description), positional (per-base), interval (regions/features)

2. Sequence Alignment

Perform pairwise and multiple sequence alignments using the pair_align engine (introduced in scikit-bio 0.7.0), a versatile and efficient dynamic-programming aligner.

Key capabilities:

• Global, local, and semi-global alignment (free ends configurable) in one function
• Convenience wrappers pair_align_nucl (BLASTN-like) and pair_align_prot (BLASTP-like)
• Configurable scoring: match/mismatch tuple or named substitution matrix; linear or affine gap penalties
• PairAlignPath results carry CIGAR strings and convert to aligned sequences
• Multiple sequence alignment with multi_align_nucl / multi_align_prot (0.7.4); storage and manipulation with TabularMSA

Common patterns:

from skbio import DNA, Protein
from skbio.alignment import pair_align_nucl, pair_align_prot, pair_align, TabularMSA

# Nucleotide alignment with BLASTN-like defaults
seq1, seq2 = DNA('ACTACCAGATTACTTACGGATCAGG'), DNA('CGAAACTACTAGATTACGGATCTTA')
aln = pair_align_nucl(seq1, seq2)
aln.score                                  # alignment score (float)
path = aln.paths[0]                        # PairAlignPath (repr shows CIGAR)
aligned_seqs = path.to_aligned((seq1, seq2))  # list of gapped strings

# Build a TabularMSA from the alignment path + original sequences
msa = TabularMSA.from_path_seqs(path, (seq1, seq2))

# Customize the algorithm via pair_align (default mode='global')
aln = pair_align(seq1, seq2, mode='local')                       # Smith-Waterman
aln = pair_align(seq1, seq2, sub_score=(2, -3), gap_cost=(5, 2), free_ends=False)
aln = pair_align(seq1, seq2, sub_score='NUC.4.4', gap_cost=3)    # substitution matrix, linear gap

# Protein alignment (BLASTP-like, BLOSUM62)
aln = pair_align_prot(Protein('HEAGAWGHEE'), Protein('PAWHEAE'))

# Read a multiple alignment from file and summarize
msa = TabularMSA.read('alignment.fasta', constructor=DNA)
consensus = msa.consensus()

Important notes:

• pair_align replaces the removed SSW wrapper (local_pairwise_align_ssw, StripedSmithWaterman) and the deprecated pure-Python aligners (global_pairwise_align, local_pairwise_align_nucleotide, etc.)
• The result is a PairAlignResult that also unpacks as score, paths, matrices (use keep_matrices=True to retain the DP matrix)
• sub_score accepts a (match, mismatch) tuple or a matrix name (e.g., 'NUC.4.4', 'BLOSUM62'); gap_cost accepts a single number (linear) or (open, extend) tuple (affine)
• mode="global" defaults to free terminal gaps (overlap); use free_ends=False for fully penalized global alignment. Affine gap cost is open + length × extend. Wrapper scoring resembles BLAST, but is not a BLAST search or E-value.
• Parse external CIGAR strings with PairAlignPath.from_cigar('1I8M2D5M2I'); score an existing alignment with align_score(...) and build a distance matrix from an MSA with align_dists(...)

3. Phylogenetic Trees

Construct, manipulate, and analyze phylogenetic trees representing evolutionary relationships.

Key capabilities:

• Tree construction from distance matrices (UPGMA/WPGMA, Neighbor Joining, GME, BME)
• Tree rearrangement with nearest neighbor interchange (nni)
• Tree manipulation (pruning, rerooting, traversal)
• Distance calculations (patristic via cophenet, Robinson-Foulds via compare_rfd)
• ASCII visualization
• Newick format I/O

Common patterns:

from skbio import TreeNode
from skbio.tree import nj, upgma, gme, bme, rf_dists

# Read tree from file
tree = TreeNode.read('tree.nwk')

# Construct tree from distance matrix
tree = nj(distance_matrix)

# Tree operations
subtree = tree.shear(['taxon1', 'taxon2', 'taxon3'])
tips = [node for node in tree.tips()]
lca = tree.lca(['taxon1', 'taxon2'])

# Calculate distances
patristic_dist = tree.find('taxon1').distance(tree.find('taxon2'))
cophenetic_dm = tree.cophenet()           # patristic distance matrix among tips

# Compare two trees (Robinson-Foulds)
rf_distance = tree.compare_rfd(other_tree)
# Pairwise RF distances among many trees -> DistanceMatrix
rf_dm = rf_dists([tree, other_tree, third_tree])

Important notes:

• Use nj() for neighbor joining (classic phylogenetic method)
• Use upgma() for UPGMA/WPGMA (assumes molecular clock)
• GME and BME are highly scalable for large trees; refine topology with nni()
• cophenet() (formerly tip_tip_distances) returns the patristic distance matrix; compare_rfd() is the Robinson-Foulds method (compare_wrfd/compare_cophenet for weighted/cophenetic variants)
• lca() is the lowest common ancestor; lowest_common_ancestor remains as an alias
• NJ/GME/BME produce unrooted trees and clamp negative branches by default; record this choice. Rooting and sequence-distance models need scientific justification. RF comparisons must use a declared shared taxon set and rooting convention.

4. Diversity Analysis

Calculate alpha and beta diversity metrics for microbial ecology and community analysis.

Key capabilities:

• Alpha diversity: richness (sobs, observed_features, chao1, ace), Shannon, Simpson, Hill numbers (hill), Faith's PD (faith_pd), generalized PD (phydiv), Pielou's evenness
• Beta diversity: Bray-Curtis, Jaccard, weighted/unweighted UniFrac, Euclidean distances
• Phylogenetic diversity metrics (require tree input)
• Rarefaction and subsampling
• Integration with ordination and statistical tests

Common patterns:

from skbio.diversity import alpha_diversity, beta_diversity

# Alpha diversity (phylogenetic metrics take taxa= for tip-name mapping)
alpha = alpha_diversity('shannon', counts_matrix, ids=sample_ids)
faith_pd = alpha_diversity('faith_pd', counts_matrix, ids=sample_ids,
                           tree=tree, taxa=feature_ids)

# Beta diversity
bc_dm = beta_diversity('braycurtis', counts_matrix, ids=sample_ids)
unifrac_dm = beta_diversity('unweighted_unifrac', counts_matrix,
                            ids=sample_ids, tree=tree, taxa=feature_ids)

# Get available metrics
from skbio.diversity import get_alpha_diversity_metrics
print(get_alpha_diversity_metrics())

Important notes:

• Keep finite, nonnegative raw counts for count-based estimators and rarefaction; never manufacture counts by scaling proportions. Shannon/Bray-Curtis can accept nonnegative abundances, but normalization changes the scientific question. Reject empty samples explicitly.
• The phylogenetic-metric argument is taxa= (renamed from otu_ids in 0.6.0; the old name is a deprecated alias); observed_otus is now observed_features (or sobs)
• counts_matrix may be any table-like input (NumPy array, pandas/polars DataFrame, BIOM Table, or AnnData) via the dispatch system
• Phylogenetic metrics (Faith's PD, UniFrac) require a rooted tree with branch lengths and unique ordered taxa-to-tip mapping
• block_beta_diversity() supports block decomposition; pass a SciPy metric callable (e.g. scipy.spatial.distance.braycurtis) instead of its string for that path. Deprecated partial_beta_diversity() fills uncomputed pairs with zero; never send that matrix to PCoA or statistical tests.
• Alpha diversity returns a pandas.Series, beta diversity returns a DistanceMatrix

5. Ordination Methods

Reduce high-dimensional biological data to visualizable lower-dimensional spaces.

Key capabilities:

• PCoA (Principal Coordinate Analysis) from distance matrices
• CA (Correspondence Analysis) for contingency tables
• CCA (Canonical Correspondence Analysis) with environmental constraints
• RDA (Redundancy Analysis) for linear relationsh

---

Content truncated.