PCR Primer Design

PCR Primer Design

Comprehensive PCR and qPCR primer design following MIQE 2.0 guidelines with automated validation.

When to Use This Skill

Use this skill when you need:

• ✅ qPCR primers with MIQE 2.0 compliance for publication
• ✅ Standard PCR primers for cloning, genotyping, or amplification (100-1000 bp)
• ✅ TaqMan probes for probe-based qPCR assays
• ✅ Rigorous validation (specificity, dimers, secondary structures)
• ✅ Publication-quality documentation with comprehensive reports

Choose application based on:

• qPCR: 70-140 bp amplicons, strict Tm matching (±2°C), MIQE compliance
• Standard PCR: 100-1000 bp amplicons, general amplification
• TaqMan: Probe-based detection, fluorescent assays
• Multiplex: Multiple targets, compatible Tm requirements
• Sequencing: Single-direction primers, Sanger sequencing

Don't use for:

• ❌ In-situ hybridization probes → use specialized oligo design tools
• ❌ NGS library prep primers → use adapter design workflows
• ❌ CRISPR guide RNAs → use CRISPR-specific design tools

Quick Start (Example)

Test this skill with a sample qPCR design in ~2 minutes:

# Example: Design qPCR primers for a 700bp target sequence
from design_qpcr_primers import design_qpcr_primers

# Sample GAPDH sequence (700 bp, exon 3-4 region)
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGCTCTCTCTTCCTCTTGTGCTCTTGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACG"

primers = design_qpcr_primers(
    sequence=sequence,
    amplicon_size_range=(80, 120),
    num_return=5
)

print(f"Found {len(primers['primers'])} primer pairs")
print(f"MIQE-compliant: {sum(p.get('miqe_compliant', False) for p in primers['primers'])}")

What you get: 3-5 MIQE-compliant primer pairs, amplicons 80-120 bp, Tm matched within 2°C

For your own data: Follow Clarification Questions below to provide your sequence.

Installation

Core packages:

pip install primer3-py biopython plotnine plotnine-prism pandas requests openpyxl

Recommended: Use virtual environment:

python -m venv pcr_env
source pcr_env/bin/activate  # Windows: pcr_env\Scripts\activate
pip install -r requirements.txt

Software Requirements

*GPL v2 permits use in AI agent applications (execution, not distribution).

NCBI API: Primer-BLAST access is free. Rate limit: 3 requests/second (no API key) or 10/second (with free API key). See references/primer_design_best_practices.md#ncbi-api-setup for API key setup.

Inputs

Required:

• Target DNA sequence in one of these formats:
  • FASTA file (local or uploaded)
  • GenBank/RefSeq accession (e.g., NM_002046)
  • Raw sequence (paste directly)
  • Gene name + organism (fetches from NCBI)

Sequence requirements:

• Minimum length: 150 bp (qPCR), 300 bp (standard PCR)
• Format: ATCG nucleotides (U converted to T)
• Quality: Avoid ambiguous bases (N) in primer regions

Optional:

• Regions to avoid (SNPs, repeats, splice sites)
• Custom parameter ranges (Tm, GC%, amplicon size)
• Organism/genome for specificity checking

See references/primer_design_best_practices.md#input-preparation for sequence preparation guidelines.

Outputs

Primary results:

• Primer sequences with properties (Tm, GC%, length, position)
• Validation report (dimers, secondary structures, specificity)
• Quality scores and QC flags

Export formats (user-selectable):

• primers.csv - Spreadsheet-compatible table
• primers.xlsx - Excel with multiple sheets (design, validation, parameters)
• primers.json - Structured data for programmatic use
• idt_order.txt - IDT ordering format (copy-paste ready)
• miqe_checklist.xlsx - MIQE 2.0 compliance documentation (qPCR only)

Visualizations (optional):

• Primer binding site alignment (SVG, 300 DPI)
• Tm distribution plots
• Secondary structure diagrams

See references/code_examples.md#export-examples for format details.

Clarification Questions

1. Input Sequence (ASK THIS FIRST)

Do you have a specific DNA sequence to design primers for?

• Option A: Upload FASTA file or provide file path
• Option B: Provide GenBank/RefSeq accession (e.g., NM_001256799)
• Option C: Provide gene name + organism (will fetch from NCBI)
• Option D: Paste sequence directly

If uploaded: Is this the complete target sequence or a specific region?

Expected: 150+ bp for qPCR, 300+ bp for standard PCR

2. PCR Application

What is your intended use for these primers?

• qPCR (Quantitative PCR) - Gene expression, 70-140 bp amplicons, MIQE-compliant
• Standard PCR - General amplification, cloning, genotyping, 100-1000 bp amplicons
• TaqMan Assay - Probe-based qPCR with fluorescent detection
• Multiplex PCR - Multiple targets simultaneously, compatible Tm required
• Sequencing - Sanger sequencing, single-direction primer
• SNP Genotyping - Allele-specific amplification

Default: qPCR (most common for gene expression studies)

3. Design Parameters

Do you want to use application-specific default parameters or customize?

• Standard parameters (recommended) - Optimized for selected application
• Custom Tm range - Specify melting temperature range (default: 58-62°C for qPCR)
• Custom amplicon size - Specify product size range
• Custom GC range - Adjust GC% (default: 40-60%)
• Avoid regions - Exclude specific sequences (SNPs, repeats, etc.)

For qPCR: Target exon-exon junction or ensure intron >1kb (MIQE guideline)?

To understand design parameters: See references/parameter_ranges.md

4. Validation Level

How thoroughly should primers be validated?

• Basic - Tm, GC%, dimer check (~1 min, sufficient for most uses)
• Standard - Basic + in-silico PCR (~2-3 min, recommended)
• Complete - Standard + NCBI Primer-BLAST (~5-10 min, publication-quality)
• MIQE-compliant - Complete + full documentation (qPCR only, ~10 min)

Note: NCBI Primer-BLAST requires internet and respects rate limits (slower but most thorough).

5. Output Requirements

What outputs do you need?

• Export format: CSV (default), Excel, JSON, IDT order format, or MIQE checklist
• Report format: Markdown (default), HTML, or text
• Visualizations: Generate primer alignment plots? (yes/no)
• Number of primers: How many primer pairs to return? (default: 5)

For qPCR: MIQE checklist is automatically generated.

Standard Workflow

Note: Run from the OmicsClaw root directory and add the workflow scripts to sys.path:

import sys; import os; sys.path.insert(0, os.path.abspath('knowledge_base/scripts/pcr-primer-design'))

🚨 EXECUTE EXACTLY AS SHOWN - Do not modify these commands.

CRITICAL: Use relative paths (knowledge_base/scripts/pcr-primer-design/, references/). DO NOT construct absolute paths.

Step 1: Load Target Sequence

Option A: Load from FASTA file

from Bio import SeqIO
record = SeqIO.read("your_sequence.fasta", "fasta")
sequence = str(record.seq)

Option B: Load from GenBank accession

See references/code_examples.md#loading-sequences for NCBI fetching code.

Option C: Paste sequence directly

# For quick testing, paste your target sequence
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGG..."  # Your sequence here

Step 2: Design Primers

Choose based on application (from Clarification Question #2):

For qPCR (most common):

from design_qpcr_primers import design_qpcr_primers

primers = design_qpcr_primers(
    sequence=sequence,
    amplicon_size_range=(70, 140),  # MIQE guideline
    tm_match_threshold=2.0,
    num_return=5
)

For Standard PCR:

from design_standard_primers import design_pcr_primers

primers = design_pcr_primers(
    sequence=sequence,
    amplicon_size_range=(100, 1000),
    tm_range=(55, 65),
    num_return=5
)

For TaqMan Assay:

from design_taqman_probes import design_taqman_assay

assay = design_taqman_assay(
    sequence=sequence,
    probe_tm_offset=8.0,  # Probe Tm = primer Tm + 8°C
    num_return=5
)

**For custo

Content truncated.